Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | . The primer and probe sequences for each assay were as follows: F. nucleatum genes forward primer, CAACCATTACTTTAACTCTACCATGTTCA; F. nucleatum genus reverse primer, ATTGACTTTACTGAGGGAGATTATGTAAAAATC; mouse GAPDH forward primer, GGTTGTCTCCTGCGACTTCA; mouse GAPDH reverse primer, TGGTCCAGGGTTTCTTACTCC.The primes were synthesized by Genscript. | Get A Quote |
Clinical evidence indicates that tumor-colonizing bacteria can be closely related to the tumor development and therapeutic responses. Selectively eliminating bacteria within tumors may be an attractive approach to enhance cancer treatment without additional side effects. Herein, it is found that, owing to the high affinity between the membrane protein Fap-2 on Fusobacterium nucleatum and d-galactose-β (1-3)-N-acetyl-d-galactosamine (Gal-GalNAc) overexpressed on colorectal tumor cells, F. nucleatum can colonize in colorectal tumors, as evidenced by both clinical samples and animal tumor models. Notably, F. nucleatum colonized in colorectal tumors can lead to an immunosuppressive tumor microenvironment, greatly ... More