Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | … plasmid contains the coding region for the mouse Prdm14 (NM_001081209.2) flanked with Gateway™ attB recombination sites (GGGGACAACTTTGTACAAAAAAGTTGGC) as well as HindIII and XhoI restriction sites (construct synthesized by GenScript, details available upon … | Get A Quote |
Understanding how the activity of transcription factors like HOX proteins is regulated remains a widely open question. In a recent screen for proteins interacting with HOXA1, we identified a PRDM protein family member, PRDM14, which is known to be transiently co-expressed with HOXA1 in epiblast cells before their specification towards somatic versus germ cell fate. Here, we confirm PRDM14 is an interactor of HOXA1 and we identify the homeodomain of HOXA1 as well as the PR domain and Zinc fingers of PRDM14 to be required for the interaction. An 11-His repeat of HOXA1 previously highlighted to contribute to HOXA1-mediated protein-protein interactions is also involved. At a functional level, we provide e... More