Products/Services Used | Details | Operation |
---|---|---|
Codon Optimization> | Plasmids Codon-optimized MERS-CoV S containing a C9 tag was purchased from Genscript and subse- quently cloned into pcDNA3.... To generate shRNA—expressing adenoviruses, gene blocks containing an shRNA targeting either the coding region of CD9 (target sequence: CCGATTCGACTCTCA GACCAA) or the 3’ UTR of TMPRSS2 (target sequence: ACACTAGAGTGGATGAATGT CTGGA), flanked by the U6 promoter and RNApolIII termination sequence, were purchased from GenScript. | Get A Quote |
Infection by enveloped coronaviruses (CoVs) initiates with viral spike (S) proteins binding to cellular receptors, and is followed by proteolytic cleavage of receptor-bound S proteins, which prompts S protein-mediated virus-cell membrane fusion. Infection therefore requires close proximity of receptors and proteases. We considered whether tetraspanins, scaffolding proteins known to facilitate CoV infections, hold receptors and proteases together on cell membranes. Using knockout cell lines, we found that the tetraspanin CD9, but not the tetraspanin CD81, formed cell-surface complexes of dipeptidyl peptidase 4 (DPP4), the MERS-CoV receptor, and the type II transmembrane serine protease (TTSP) member TMPRSS2, a C... More