Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | Golgin 104/CG4925 gRNA target: GTAATCATTGCGTACCGCTT Genscript N/A | Get A Quote |
PCR Cloning and Subcloning> | Get A Quote |
Fast axonal transport of neuropeptide-containing dense core vesicles (DCVs), endolysosomal organelles, and presynaptic components is critical for maintaining neuronal functionality. How the transport of DCVs is orchestrated remains an important unresolved question. The small GTPase Rab2 mediates DCV biogenesis and endosome-lysosome fusion. Here, we use Drosophila to demonstrate that Rab2 also plays a critical role in bidirectional axonal transport of DCVs, endosomes, and lysosomal organelles, most likely by controlling molecular motors. We further show that the lysosomal motility factor Arl8 is required as well for axonal transport of DCVs, but unlike Rab2, it is also critical for DCV exit from cell bodies into... More