Products/Services Used | Details | Operation |
---|---|---|
Proteins, Expression, Isolation and Analysis> | … : GTTTACTATCACGGCTCCAA and GGGGAGAGCCTCGCTGCCAA) were purchased from Integrated DNA Technologies and lentiviral plasmids were obtained from Genscript (… | Get A Quote |
Exosomal PD-L1 (exoPD-L1) has recently received significant attention as a biomarker predicting immunotherapeutic responses involving the PD1/PD-L1 pathway. However, current technologies for exosomal analysis rely primarily on bulk measurements that do not consider the heterogeneity found within exosomal subpopulations. Here, we present a nanoscale cytometry platform NanoEPIC, enabling phenotypic sorting and exoPD-L1 profiling from blood plasma. We highlight the efficacy of NanoEPIC in monitoring anti-PD-1 immunotherapy through the interrogation of exoPD-L1. NanoEPIC generates signature exoPD-L1 patterns in responders and non-responders. In mice treated with PD1-targeted immunotherapy, exoPD-L1 is correlated w... More