Products/Services Used | Details | Operation |
---|---|---|
Custom DNA/RNA Oligos> | The 5′-biotinylated oligonucleotides (90 nt) (5′-CGACAGGTCATGGCCGTACATGAT‐ATCCTCGAGCGGTCCTGTTGCAACTTACACTCTGAATAGCCGAATTCTTAGGGTTAG‐GGTTAACA-3′) were immobilized on streptavidin MagBeads (GenScript) | Get A Quote |
The ubiquitin E3 ligase Bre1-mediated H2B monoubiquitination (H2Bub) is essential for proper DNA replication and repair in eukaryotes. Deficiency in H2Bub causes genome instability and cancer. How the Bre1-H2Bub pathway is evoked in response to DNA replication or repair remains unknown. Here, we identify that the single-stranded DNA (ssDNA) binding factor RPA acts as a key mediator that couples Bre1-mediated H2Bub to DNA replication and repair in yeast. We found that RPA interacts with Bre1 in vitro and in vivo, and this interaction is stimulated by ssDNA. This association ensures the recruitment of Bre1 to replication forks or DNA breaks but does not affect its E3 ligase activity. Disruption of the interaction... More